Journal: Molecular Oncology

Article Title: Overexpression of the pro‐protein convertase furin predicts prognosis and promotes papillary thyroid carcinoma progression and metastasis through RAF / MEK signaling

doi: 10.1002/1878-0261.13396

Figure Lengend Snippet: Knockdown of FURIN decrease PTC cell growth and induce apoptosis. (A, B) Silencing of FURIN attenuates clonogenicity. PTC cells were transfected with scrambled siRNA and two different FURIN siRNA sequences (25 n m ). After 48 h, cells were seeded at a density of 500 cells per well in a 6‐well plate and grown for an additional 10 days, then stained with crystal violet, and colonies were counted. Data were presented as mean ± SD ( n = 3). (C) Depletion of furin induces apoptosis in PTC cell lines. After 48 h of transfection, cells were stained with fluorescein‐conjugated annexin‐V and propidium iodide (PI) and analyzed by flow cytometry. Data were presented as mean ± SD ( n = 3). (D) Depletion of furin induces the cleavage of caspase‐3 and PARP. After 48 h of transfection, cells were lysed and proteins were immuno‐blotted with antibodies against Furin, PARP, casapse‐3, cleaved casapse‐3, and β‐Actin as indicated ( n = 3). Statistical analyses were performed using two‐tailed Student's t ‐tests. * P < 0.05.

Article Snippet: FURIN cDNA encoding human FURIN (RC204279) and shRNA's (TR312903A: AAAGTGATTAAACGTGCAGACTATGCAAA and TR312903B: ACGGCATTGTGGTCTCCATTCTGGACGAT) targeting human FURIN were purchased from Origene.

Techniques: Knockdown, Transfection, Staining, Flow Cytometry, Two Tailed Test

Journal: Molecular Oncology

Article Title: Overexpression of the pro‐protein convertase furin predicts prognosis and promotes papillary thyroid carcinoma progression and metastasis through RAF / MEK signaling

doi: 10.1002/1878-0261.13396

Figure Lengend Snippet: Furin activates MEK/ERK pathway. (A) Forced expression of furin stimulates MEK/ERK pathway. TPC‐1 cells were transfected with either an empty vector or FURIN cDNA for 48 h. Cells were lysed and proteins were immuno‐blotted with antibodies against Furin, pMEK1/2, MEK1/2, pERK1/2, ERK1/2, and β‐Actin as indicated ( n = 3). (B) Depletion of furin inhibits MEK/ERK activation. PTC cells were transfected with a control shRNA vector or two different FURIN shRNA constructs. After transfection, cells were lysed and proteins were immuno‐blotted with antibodies against Furin, pMEK1/2, MEK1/2, pERK1/2, ERK1/2, and β‐Actin as indicated ( n = 3). (C) The effect of MEK inhibitors on furin expression. PTC cell lines were treated with a pharmacological inhibitor for MEK, mirdametinib (10 nM), and selumetinib (20 nM) for 48 h and analyzed the expression of Furin, pMEK1/2, MEK1/2, pERK1/2, ERK1/2 by immunoblotting ( n = 3). (D) Selumetinib downregulates MEK/ERK signaling cascade in furin‐expressing cells. TPC‐1 cells carrying FURIN cDNA were treated with selumetinib (20 nM) for 48 h. Cells were lysed and proteins were immuno‐blotted with antibodies against Furin, pMEK1/2, MEK1/2, pERK1/2, ERK1/2, and β‐Actin as indicated ( n = 3). (E) The co‐inhibition of MEK and furin further downregulate MEK/ERK signaling cascade in PTC cells. PTC cells were transfected with FURIN shRNA, and treated with selumetinib (20 nM) for 48 h. Cells were lysed and proteins were immuno‐blotted with antibodies against Furin, pMEK1/2, MEK1/2, pERK1/2, ERK1/2, and β‐Actin as indicated ( n = 3).

Article Snippet: FURIN cDNA encoding human FURIN (RC204279) and shRNA's (TR312903A: AAAGTGATTAAACGTGCAGACTATGCAAA and TR312903B: ACGGCATTGTGGTCTCCATTCTGGACGAT) targeting human FURIN were purchased from Origene.

Techniques: Expressing, Transfection, Plasmid Preparation, Activation Assay, Control, shRNA, Construct, Western Blot, Inhibition

Journal: Molecular Oncology

Article Title: Overexpression of the pro‐protein convertase furin predicts prognosis and promotes papillary thyroid carcinoma progression and metastasis through RAF / MEK signaling

doi: 10.1002/1878-0261.13396

Figure Lengend Snippet: The MEK/ERK signaling pathway plays an important role in furin‐mediated cell growth and apoptosis. (A) TPC‐1 cells carrying empty vector or FURIN cDNA were treated with selumetinib (20 nM) for 48 h and the cells were subjected to clonogenic assay. Data were presented as mean ± SD ( n = 3). (B) PTC cells were transfected with FURIN siRNA and treated with selumetinib (20 nM) for 48 h and the cells were subjected to clonogenic assay. Data were presented as mean ± SD ( n = 3). (C) TPC‐1 cells carrying empty vector or FURIN cDNA were treated with selumetinib (20 nM). After 48 h, cells were analyzed for apoptosis by annexin‐V/PI. Data were presented as mean ± SD ( n = 3). (D) PTC cells were transfected with FURIN siRNA and treated with selumetinib (20 nM). After 48 h, cells were analyzed for apoptosis. Data were presented as mean ± SD ( n = 3). Statistical analyses were performed using two‐tailed Student's t ‐tests. * P < 0.05.

Article Snippet: FURIN cDNA encoding human FURIN (RC204279) and shRNA's (TR312903A: AAAGTGATTAAACGTGCAGACTATGCAAA and TR312903B: ACGGCATTGTGGTCTCCATTCTGGACGAT) targeting human FURIN were purchased from Origene.

Techniques: Plasmid Preparation, Clonogenic Assay, Transfection, Two Tailed Test

Journal: Molecular Oncology

Article Title: Overexpression of the pro‐protein convertase furin predicts prognosis and promotes papillary thyroid carcinoma progression and metastasis through RAF / MEK signaling

doi: 10.1002/1878-0261.13396

Figure Lengend Snippet: Furin promotes the self‐renewal ability of spheroids generated from PTC cells. (A, B) Forced expression of furin increases spheroid growth. TPC‐1 cells were transfected with either empty vector or FURIN cDNA and cells were subjected to sphere‐forming assay, (scale bar = 1 mm). Spheroids in the entire dish were counted. Data were presented as mean ± SD ( n = 3). (C) Forced expression of furin increases the stemness of spheroids as confirmed by immunoblotting using stem cell markers. TPC‐1 cells were transfected with either empty vector or FURIN cDNA and grown in a sphere medium. Proteins were isolated from spheroids and immunoblotted with antibodies against Furin, CD44, CD133, NANOG, and β‐Actin ( n = 3). (D, E) Depletion of furin attenuates the self‐renewal ability of spheroids. PTC cells were transfected with FURIN shRNA and cells were subjected to a sphere‐forming assay, (scale bar = 1 mm). Spheroids in the entire well were counted. Data were presented as mean ± SD ( n = 3). (F) Depletion of furin reduces the stemness of spheroids. PTC cells were transfected with FURIN shRNA and grown in a sphere medium. Proteins were isolated from spheroids and immunoblotted with antibodies against Furin, CD44, CD133, NANOG, and β‐Actin ( n = 3). Statistical analyses were performed using two‐tailed Student's t ‐tests. * P < 0.05.

Article Snippet: FURIN cDNA encoding human FURIN (RC204279) and shRNA's (TR312903A: AAAGTGATTAAACGTGCAGACTATGCAAA and TR312903B: ACGGCATTGTGGTCTCCATTCTGGACGAT) targeting human FURIN were purchased from Origene.

Techniques: Generated, Expressing, Transfection, Plasmid Preparation, Western Blot, Isolation, shRNA, Two Tailed Test

Journal: Molecular Oncology

Article Title: Overexpression of the pro‐protein convertase furin predicts prognosis and promotes papillary thyroid carcinoma progression and metastasis through RAF / MEK signaling

doi: 10.1002/1878-0261.13396

Figure Lengend Snippet: Inhibition of MEK decreases spheroid growth and stemness in both furin expressing and knockdown cells. (A) TPC‐1 cells carrying either empty vector or FURIN cDNA were treated with selumetinib (20 nM) for 48 h and the cells were subjected to sphere‐forming assay. Data were presented as mean ± SD ( n = 3). (B) PTC cells carrying either empty vector or FURIN shRNA were treated with selumetinib (20 nM) for 48 h and the cells were subjected to sphere‐forming assay. Data were presented as mean ± SD ( n = 3). (C) TPC‐1 cells carrying either empty vector or FURIN cDNA were treated with selumetinib (20 nM) for 48 h and grown in a sphere medium. Proteins were isolated from spheroids and immunoblotted with antibodies against Furin, CD44, CD133, NANOG, and β‐Actin ( n = 3). (D) PTC cells carrying either empty vector or FURIN shRNA were treated with selumetinib (20 nM) for 48 h and grown in a sphere medium. Proteins were isolated from spheroids and immunoblotted with antibodies against Furin, CD44, CD133, NANOG, and β‐Actin ( n = 3). Statistical analyses were performed using two‐tailed Student's t ‐tests. * P < 0.05.

Article Snippet: FURIN cDNA encoding human FURIN (RC204279) and shRNA's (TR312903A: AAAGTGATTAAACGTGCAGACTATGCAAA and TR312903B: ACGGCATTGTGGTCTCCATTCTGGACGAT) targeting human FURIN were purchased from Origene.

Techniques: Inhibition, Expressing, Knockdown, Plasmid Preparation, shRNA, Isolation, Two Tailed Test

Journal: Molecular Oncology

Article Title: Overexpression of the pro‐protein convertase furin predicts prognosis and promotes papillary thyroid carcinoma progression and metastasis through RAF / MEK signaling

doi: 10.1002/1878-0261.13396

Figure Lengend Snippet: Depletion of furin attenuates EMT and metastatic potential of PTC cells. (A) PTC cells were transfected with a control shRNA vector or two different FURIN shRNA constructs. After transfection, cells were lysed and proteins were immuno‐blotted with antibodies against Furin, E‐cadherin, N‐cadherin, Zeb1, Twist, and β‐Actin as indicated ( n = 3). (B, C) Knockdown of FURIN decreases the invasive ability of PTC cells. PTC cells were transfected with FURIN shRNA's and cells were subjected to invasion assay. (scale bar = 1 mm). Data were presented as mean ± SD ( n = 3). (D) Knockdown of FURIN decreases the migratory ability of PTC cells. PTC cells were transfected with FURIN shRNA's and cells were subjected to migration assay. Data were presented as mean ± SD ( n = 3). (E) The co‐inhibition of MEK and furin further reduce EMT in PTC cells. PTC cells carrying either empty vector or FURIN shRNA were treated with selumetinib (20 nM) for 48 h. After cell lysis, proteins were immuno‐blotted with antibodies against Furin, E‐cadherin, N‐cadherin, Zeb1, Twist, and β‐Actin as indicated ( n = 3). (F, G) The co‐inhibition of MEK and furin further decreases the invasion and migration of PTC cells. PTC cells carrying either empty vector or FURIN shRNA were treated with selumetinib (20 nM) for 48 h and the cells were subjected to invasion and migration assay. Data were presented as mean ± SD ( n = 3). Statistical analyses were performed using two‐tailed Student's t ‐tests. * P < 0.05.

Article Snippet: FURIN cDNA encoding human FURIN (RC204279) and shRNA's (TR312903A: AAAGTGATTAAACGTGCAGACTATGCAAA and TR312903B: ACGGCATTGTGGTCTCCATTCTGGACGAT) targeting human FURIN were purchased from Origene.

Techniques: Transfection, Control, shRNA, Plasmid Preparation, Construct, Knockdown, Invasion Assay, Migration, Inhibition, Lysis, Two Tailed Test

Journal: Molecular Oncology

Article Title: Overexpression of the pro‐protein convertase furin predicts prognosis and promotes papillary thyroid carcinoma progression and metastasis through RAF / MEK signaling

doi: 10.1002/1878-0261.13396

Figure Lengend Snippet: Depletion of furin delayed tumor growth in vivo . (A) BCPAP cells were transfected with empty vector and FURIN shRNA, subcutaneously inoculated into the right flanks of NU/J mice ( n = 5). The tumor volume (B) and mouse body weight were monitored weekly. After 4 weeks, mice were sacrificed and individual tumors were weighed (C). Data were presented as mean ± SD ( n = 5). (D) Tumors were lysed and proteins were immuno‐blotted with antibodies against Furin, pMEK1/2, MEK1/2, pERK1/2, ERK1/2, E‐cadherin, N‐cadherin, Zeb1, Twist and β‐Actin as indicated ( n = 3). Statistical analyses were performed using two‐tailed Student's t ‐tests. * P < 0.05.

Article Snippet: FURIN cDNA encoding human FURIN (RC204279) and shRNA's (TR312903A: AAAGTGATTAAACGTGCAGACTATGCAAA and TR312903B: ACGGCATTGTGGTCTCCATTCTGGACGAT) targeting human FURIN were purchased from Origene.

Techniques: In Vivo, Transfection, Plasmid Preparation, shRNA, Two Tailed Test